Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.091431 |
Chromosome: | chromosome 9 |
Location: | 6575350 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g408250 | EEF1A2 | Eukaryotic translation elongation factor 1-alpha; (1 of 1) PTHR23115//PTHR23115:SF170 - TRANSLATION FACTOR // ELONGATION FACTOR 1-ALPHA 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGACTGGCTGACAGCTCCACTCGCTGT |
Internal bar code: | CTGTCCGCTGAACCCATGGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 563 |
LEAP-Seq percent confirming: | 89.8973 |
LEAP-Seq n confirming: | 1575 |
LEAP-Seq n nonconfirming: | 177 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACTTGTTTTCCTGCACCC |
Suggested primer 2: | CATGATGCCGAAAGAAACCT |