| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.091498 |
| Chromosome: | chromosome 17 |
| Location: | 5944476 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g740261 | FAP365 | (1 of 96) IPR019734 - Tetratricopeptide repeat; Flagellar Associated Protein 365 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGTGAGGCAGGGCGGCGGGCTGGAGGTG |
| Internal bar code: | CAACTGCTCTCGCACAGTGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 326 |
| LEAP-Seq percent confirming: | 99.7219 |
| LEAP-Seq n confirming: | 10039 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTTCAGTAACCCCCGTAT |
| Suggested primer 2: | GTTCAGTGTGGTGTCGGATG |