Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.091714 |
Chromosome: | chromosome 2 |
Location: | 6261712 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g114300 | (1 of 6) PTHR22916//PTHR22916:SF9 - GLYCOSYLTRANSFERASE // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGCGCACCGCCACCGACGCAGCAGCAG |
Internal bar code: | TATTTAATCATTAGGTCGATAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 347 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 245 |
LEAP-Seq n nonconfirming: | 49 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTGCTGTTATTGCCAGCG |
Suggested primer 2: | CTAATCGCGAATGATGGGTT |