Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.091714 |
Chromosome: | chromosome 3 |
Location: | 7295332 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g206950 | (1 of 1) PF05183 - RNA dependent RNA polymerase (RdRP) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATGCAGGAAACGTTTCACACCAAAAGGG |
Internal bar code: | ATTGGGGTATTGGTATCCGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 421 |
LEAP-Seq percent confirming: | 98.8701 |
LEAP-Seq n confirming: | 700 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTGCGTTGTTGCTTGACAG |
Suggested primer 2: | TTCAGTCGCATGGTGTCATT |