| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.091827 |
| Chromosome: | chromosome 7 |
| Location: | 853055 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318551 | CYA8 | Adenylate cyclase; (1 of 1) PF00211//PF13855 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Leucine rich repeat (LRR_8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTACTGCACACCCGGACACAAACCCACC |
| Internal bar code: | CAGAGTGTGTTAGAAGGCTGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 455 |
| LEAP-Seq percent confirming: | 99.0966 |
| LEAP-Seq n confirming: | 1755 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGTGAGGTGGTGAGAAG |
| Suggested primer 2: | TTGTTGCTTACACACACGCA |