Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.091885 |
Chromosome: | chromosome 1 |
Location: | 5096766 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g035450 | (1 of 1) PTHR23291:SF36 - PROTEIN XBX-6, ISOFORM B | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAATACTCAGACAGGGCATCCCTTCACA |
Internal bar code: | GAACTGAGGGTGGGACGAATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 275 |
LEAP-Seq percent confirming: | 32.0382 |
LEAP-Seq n confirming: | 940 |
LEAP-Seq n nonconfirming: | 1994 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCAAGTCCCCAAGGTTTAT |
Suggested primer 2: | CGCTCAACCTCTACCTCGAC |