Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.091897 |
Chromosome: | chromosome 10 |
Location: | 4481643 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g451752 | PHC25 | Putative pherophorin-chlamydomonas homolog; (1 of 71) PF12499 - Pherophorin (DUF3707) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATGCCTCCCCATCCCCCGGGAAGGAATA |
Internal bar code: | ACGTAGGGACGAGGCCGCTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 73 |
LEAP-Seq percent confirming: | 53.5047 |
LEAP-Seq n confirming: | 1145 |
LEAP-Seq n nonconfirming: | 995 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGCTGCTTGTTGTCATAGG |
Suggested primer 2: | CTAGGCGACGGTAGAACTCG |