| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.091985 |
| Chromosome: | chromosome 17 |
| Location: | 1961737 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g710850 | TPT4,TPT29 | UDP-xylose transporter; (1 of 4) K15285 - solute carrier family 35, member E3 (SLC35E3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGCAGTCCAGGCGGTGCGGTCCCCGTG |
| Internal bar code: | ACTATGGGTGTCGCGTCGATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 610 |
| LEAP-Seq percent confirming: | 99.1724 |
| LEAP-Seq n confirming: | 4314 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCACCTCAAAACACTCAT |
| Suggested primer 2: | TGTATGGCTGGTTGTTGCAT |