Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.091998 |
Chromosome: | chromosome 7 |
Location: | 2949794 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g332851 | SELM2,SELENOM,SELM | (1 of 1) PTHR13077:SF7 - SELENOPROTEIN M; Selenoprotein M | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGACGCCCCGGCCGTCATAAGGCCAACG |
Internal bar code: | ATTTCCTTCAGGGGGCTCGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 463 |
LEAP-Seq percent confirming: | 95.881 |
LEAP-Seq n confirming: | 2095 |
LEAP-Seq n nonconfirming: | 90 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCGGATTGCATTGTAACTT |
Suggested primer 2: | AACACCTGGGTGAAGTCGTC |