Insertion junction: LMJ.RY0402.092005_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.092005
Chromosome:chromosome_1
Location:2341970
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g012800 FAP230 Flagellar Associated Protein sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TAGTTCTCATGCTGCTGCGAGACAGCATAA
Internal bar code:CATTTCCCCGGCGCCGACGAGC

Confirmation - LEAP-Seq

LEAP-Seq distance:342
LEAP-Seq percent confirming:64.0074
LEAP-Seq n confirming:1035
LEAP-Seq n nonconfirming:582
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:ACATCCACCACCTCTGAAGC
Suggested primer 2:TCCGCGATGTGTTACCATAA