| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092021 |
| Chromosome: | chromosome 8 |
| Location: | 4708784 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g384000 | CYP26,CYP771A1 | (1 of 3) IPR001128//IPR002397//IPR002401//IPR002403 - Cytochrome P450 // Cytochrome P450, B-class // Cytochrome P450, E-class, group I // Cytochrome P450, E-class, group IV; Cytochrome P450, CYP197 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCCGCAGTGACCCAAGCGATTTGTGGT |
| Internal bar code: | TCGCTGGCTGAGCGGGAGCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 351 |
| LEAP-Seq percent confirming: | 99.1214 |
| LEAP-Seq n confirming: | 4400 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGTGTGTGTGTGTGTGT |
| Suggested primer 2: | CTTGTGAGCTCCGCCTACAC |