| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092027 |
| Chromosome: | chromosome 2 |
| Location: | 3269922 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095080 | (1 of 1) IPR001107//IPR002499 - Band 7 protein // Major vault protein, N-terminal | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGCTGCAGCATACAAAATGAACCTCTC |
| Internal bar code: | TAAGCAGACTCTGCAATGGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 586 |
| LEAP-Seq percent confirming: | 72.2892 |
| LEAP-Seq n confirming: | 2160 |
| LEAP-Seq n nonconfirming: | 828 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCTGCAAGCACTCAAGCA |
| Suggested primer 2: | GGCGCAGAAAGAATAACAGC |