| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092042 |
| Chromosome: | chromosome 6 |
| Location: | 4156565 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278229 | (1 of 3) IPR000104//IPR004333 - Antifreeze protein, type I // Transcription factor, SBP-box | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACAGCACCAGCAACAACAACAGCAGCT |
| Internal bar code: | TGACGACGGCCGCGGATTCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 740 |
| LEAP-Seq percent confirming: | 91.1851 |
| LEAP-Seq n confirming: | 4055 |
| LEAP-Seq n nonconfirming: | 392 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGGACACCTCTCAGCAT |
| Suggested primer 2: | GCTGCTGCAACAACCATAGA |