| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.092088 |
| Chromosome: | chromosome 1 |
| Location: | 6558679 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g046850 | UBC13 | E2 Ubiquitin conjugating enzyme; (1 of 1) K04649 - ubiquitin-conjugating enzyme (huntingtin interacting protein 2) (HIP2, UBC1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGACAAAACTACCCCACCCCCCAGCCAC |
| Internal bar code: | CCTGTTCTAGATCCCCTACCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 469 |
| LEAP-Seq percent confirming: | 99.0958 |
| LEAP-Seq n confirming: | 548 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGTAACGTGTGCGAGTG |
| Suggested primer 2: | CGCTCCATCCAAACTCATTT |