Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.092104 |
Chromosome: | chromosome 6 |
Location: | 1252672 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g257950 | AST4 | (1 of 1) K14455 - aspartate aminotransferase, mitochondrial (GOT2); aspartate aminotransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGGGAAAGGCTGGTCTGCGCTCGGTTTC |
Internal bar code: | TGGGAGTATCTAGAGCCGTCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 266 |
LEAP-Seq percent confirming: | 57.2908 |
LEAP-Seq n confirming: | 2766 |
LEAP-Seq n nonconfirming: | 2062 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCACATACACACGCTCTCT |
Suggested primer 2: | GTGTAGAAGACGAGAGGCGG |