| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.092107 |
| Chromosome: | chromosome 9 |
| Location: | 645730 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g403300 | (1 of 1) K03144 - transcription initiation factor TFIIH subunit 4 (TFIIH4, GTF2H4, TFB2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGCACTCTCCTATGACTGGCCCCAACGC |
| Internal bar code: | AGCGCGTTTTCTTGTTCTTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 372 |
| LEAP-Seq percent confirming: | 98.3902 |
| LEAP-Seq n confirming: | 1039 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTATGGATGCCCTCTCCTC |
| Suggested primer 2: | GATCTGGTCCGACACAACCT |