| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092113 |
| Chromosome: | chromosome 1 |
| Location: | 4061783 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g026550 | CCT7 | T-complex protein 1, eta subunit; (1 of 1) K09499 - T-complex protein 1 subunit eta (CCT7) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCCCAGCTGTTCATCAGGGCGTTTGCCA |
| Internal bar code: | TGGGCATGCCGAGCCCGGCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 589 |
| LEAP-Seq percent confirming: | 98.7714 |
| LEAP-Seq n confirming: | 12300 |
| LEAP-Seq n nonconfirming: | 153 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAAGAAAAGGAAAGGTGG |
| Suggested primer 2: | GTCTCGTCCACCGACAGAAT |