| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.092121 |
| Chromosome: | chromosome 5 |
| Location: | 1652007 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243150 | Carbonic anhydrase-related protein; (1 of 1) PF04357 - Family of unknown function (DUF490) (DUF490) | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGCTTCGTTATTACACAGCATATATTTA |
| Internal bar code: | CCAAGTAAGAGATAGGGTTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 684 |
| LEAP-Seq percent confirming: | 93.2878 |
| LEAP-Seq n confirming: | 5059 |
| LEAP-Seq n nonconfirming: | 364 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTTGGGACCACAGCAAAT |
| Suggested primer 2: | AGGCGCTAGAGAGCAGAGTG |