| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092129 |
| Chromosome: | chromosome 4 |
| Location: | 2009982 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g218850 | RNP | (1 of 1) K14846 - ribosome production factor 1 (RPF1); Putative small nucleolar ribonucleoprotein U3 protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCTGTGGGCCGTCATCGGGCGCTGGCCA |
| Internal bar code: | CTGTGTCTCAGTCTGCGGGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 775 |
| LEAP-Seq percent confirming: | 98.6619 |
| LEAP-Seq n confirming: | 7226 |
| LEAP-Seq n nonconfirming: | 98 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGTTGCAGACCCCTGAGC |
| Suggested primer 2: | GGTTGGAAACATTTCCGTTG |