| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.092264 |
| Chromosome: | chromosome 6 |
| Location: | 2103191 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g265150 | (1 of 1) K11833 - ubiquitin carboxyl-terminal hydrolase 2/21 [EC:3.4.19.12] (USP2_21) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTGCCTGGCAGCCCAACAACCGTACAA |
| Internal bar code: | CGCCGCTCTACAGGAGATGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 121 |
| LEAP-Seq percent confirming: | 91.2506 |
| LEAP-Seq n confirming: | 3911 |
| LEAP-Seq n nonconfirming: | 375 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAGTAGCAAGTCCTCCAG |
| Suggested primer 2: | TCCCCTCCACTCTACACACC |