| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092330 |
| Chromosome: | chromosome 16 |
| Location: | 4025607 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g670300 | PRP39 | (1 of 1) K13217 - pre-mRNA-processing factor 39 (PRPF39, PRP39); Nuclear pre-mRNA splicing factor and U1 snRNP Component | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGAATGAGGCGGGGTGGTGGGGAACGC |
| Internal bar code: | GGGACCCCAATGGACGGACAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 138 |
| LEAP-Seq percent confirming: | 48.3766 |
| LEAP-Seq n confirming: | 596 |
| LEAP-Seq n nonconfirming: | 636 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACGGTAGTTAACAGGCGGG |
| Suggested primer 2: | AGGTTGCTTTCTGAGGCGTA |