| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.092344 |
| Chromosome: | chromosome 16 |
| Location: | 5036038 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684550 | HAR2 | Possible 3-hydroxyacid dehydrogenase; (1 of 3) 1.1.1.26 - Glyoxylate reductase / NADH-dependent glyoxylate reductase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTCCTTGAGCTGGGGGCGCACGGACGGG |
| Internal bar code: | GAGGCGTGGATGTCGACCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 814 |
| LEAP-Seq percent confirming: | 99.6855 |
| LEAP-Seq n confirming: | 24410 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTTTGCAAGAAATGCTGC |
| Suggested primer 2: | CAGTTGATGTCGCTGGCTAA |