| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092353 |
| Chromosome: | chromosome 15 |
| Location: | 443658 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g636400 | (1 of 2) K13989 - Derlin-2/3 (DERL2_3) | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCAATTGCAGCGGCCGTGTGACCCGCCC |
| Internal bar code: | TAGCGTACCGGCGACAGGCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 694 |
| LEAP-Seq percent confirming: | 98.995 |
| LEAP-Seq n confirming: | 197 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGTGCAACACCAGACTGA |
| Suggested primer 2: | TAAACACCAGCTTTGCGTTG |