| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092408 |
| Chromosome: | chromosome 15 |
| Location: | 45458 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g634600 | (1 of 1) PF12796//PF13637//PF13857 - Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_4) // Ankyrin repeats (many copies) (Ank_5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCCCCTGGCCTGCCTGGTCCCCTCCGGG |
| Internal bar code: | CGTGCTGGGTTGGCCGGAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 208 |
| LEAP-Seq percent confirming: | 96.5587 |
| LEAP-Seq n confirming: | 477 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTGATGTCACCTGTCCG |
| Suggested primer 2: | TGCTTTTGAGTACCCGCTCT |