| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092498 |
| Chromosome: | chromosome 2 |
| Location: | 4274144 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g099050 | SRR30 | (1 of 20) IPR001190//IPR017448 - SRCR domain // SRCR-like domain; Scavenger receptor cysteine-rich protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGATACCAGCAGTTGCCGGTCCTCCGA |
| Internal bar code: | CGGCATACGGGTCATCAACATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 761 |
| LEAP-Seq percent confirming: | 98.4049 |
| LEAP-Seq n confirming: | 2591 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCAAAGTCGAGGGTTAG |
| Suggested primer 2: | GTACAAGAAGGGCAGCAAGC |