| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092507 |
| Chromosome: | chromosome 2 |
| Location: | 4654402 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g101300 | (1 of 25) IPR000210//IPR011333 - BTB/POZ domain // POZ domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCACCCCCGGCACCGTGCACCACCGCAA |
| Internal bar code: | TCCGCAAACGGCGGTTAAAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1245 |
| LEAP-Seq percent confirming: | 94.1019 |
| LEAP-Seq n confirming: | 351 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAACTGTCCCCAAGGCTAC |
| Suggested primer 2: | GGTTGGCAATGTAGCCTTGT |