| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092535 |
| Chromosome: | chromosome 2 |
| Location: | 5988411 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g112200 | TRP22 | (1 of 1) IPR001680//IPR005821//IPR011045//IPR017986//IPR020683 - WD40 repeat // Ion transport domain // Nitrous oxide reductase, N-terminal // WD40-repeat-containing domain // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCCTACCTTGAGTGCACATGCACACATT |
| Internal bar code: | GGCGGCGTCGAGGGAGGGGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 281 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 315 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCAGCAGCAAATGCACAAG |
| Suggested primer 2: | AGTTCCAGGGCATTTGAGTG |