| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092542 |
| Chromosome: | chromosome 4 |
| Location: | 3936985 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g231124 | (1 of 1) PF00397//PF00642 - WW domain (WW) // Zinc finger C-x8-C-x5-C-x3-H type (and similar) (zf-CCCH) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGCACTTTTGCACTTCGCGTCAACTTG |
| Internal bar code: | TGATGTAGAAACCACGCAGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 685 |
| LEAP-Seq percent confirming: | 98.9318 |
| LEAP-Seq n confirming: | 5094 |
| LEAP-Seq n nonconfirming: | 55 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAAACTGTCTTCCGTCTG |
| Suggested primer 2: | CACCTGCAACCACTGCTTTA |