| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092610 |
| Chromosome: | chromosome 12 |
| Location: | 3710808 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514650 | CNK6 | (1 of 1) PF10498//PF14531 - Intra-flagellar transport protein 57 (IFT57) // Kinase-like (Kinase-like); NIMA-related kinase 6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTGCGCTGACAGGTTCCTAACGCAGTG |
| Internal bar code: | AGGACAGCCCGCCTAGACCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 617 |
| LEAP-Seq percent confirming: | 98.9595 |
| LEAP-Seq n confirming: | 856 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTTTAGTTTGGGCTGGTA |
| Suggested primer 2: | GCGTTGTTTTGGGTTGAAGT |