| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.092644 |
| Chromosome: | chromosome 8 |
| Location: | 2560357 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g372500 | (1 of 1) K11373 - elongator complex protein 1 (ELP1, IKI3, IKBKAP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTTTTGTTGTTTTTTTCTCTCACACACA |
| Internal bar code: | TGTCACATTCTGTTTCTCTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 114 |
| LEAP-Seq percent confirming: | 94.3089 |
| LEAP-Seq n confirming: | 116 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGACAGCTTCATTCCCGCT |
| Suggested primer 2: | ACCCTCGTAACCTGCATTTG |