| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092670 |
| Chromosome: | chromosome 2 |
| Location: | 3511609 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095125 | (1 of 1) IPR000104//IPR000408//IPR009091 - Antifreeze protein, type I // Regulator of chromosome condensation, RCC1 // Regulator of chromosome condensation 1/beta-lactamase-inhibitor protein II | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGCCTCCTCCCCCTCCGCCCGGCATGCA |
| Internal bar code: | CTGGCGGGTAGAGGCGCTTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 77 |
| LEAP-Seq percent confirming: | 89.0411 |
| LEAP-Seq n confirming: | 130 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCAGTCTACGGATGGTGC |
| Suggested primer 2: | TCCAGACCTCAGCACATCAG |