Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.092721 |
Chromosome: | chromosome 10 |
Location: | 4084002 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g449700 | (1 of 7) PF00582 - Universal stress protein family (Usp) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAATTGGGTGCACCGCCTGCTTTACGCGG |
Internal bar code: | TCCTTTTTTCGGAAGGCGTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 816 |
LEAP-Seq percent confirming: | 98.3942 |
LEAP-Seq n confirming: | 4718 |
LEAP-Seq n nonconfirming: | 77 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTAAACGCTCCTCTGAACG |
Suggested primer 2: | GGAACTTGTGGAGGCATCAT |