| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.092813 |
| Chromosome: | chromosome 7 |
| Location: | 3247614 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g334200 | HEL38 | (1 of 1) K13116 - ATP-dependent RNA helicase DDX41 [EC:3.6.4.13] (DDX41, ABS); DEAD box ATP-dependent RNA helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTACGGCCTCCCAACTTACACCTCACG |
| Internal bar code: | CTTGGGTTTCGGGCGGTGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 572 |
| LEAP-Seq percent confirming: | 99.4693 |
| LEAP-Seq n confirming: | 1687 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATGCACTTTTTGATGCCC |
| Suggested primer 2: | TCTGGTGAAGACGTGCAAAG |