| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092833 |
| Chromosome: | chromosome 17 |
| Location: | 3792781 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g727700 | HEL65 | (1 of 2) K16911 - ATP-dependent RNA helicase DDX21 [EC:3.6.4.13] (DDX21); DEAD box ATP-dependent RNA helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTTTGTTGGTCAAGGTGGTTGCTTAGAT |
| Internal bar code: | ACCGGCATCAGATGTGTGCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 489 |
| LEAP-Seq percent confirming: | 98.3988 |
| LEAP-Seq n confirming: | 4732 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGGCAATAGGGAGTTCTT |
| Suggested primer 2: | CCTCGCAGTAACCCAATGAT |