| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.092838 |
| Chromosome: | chromosome 6 |
| Location: | 1283764 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g258226 | (1 of 5) 3.2.1.23 - Beta-galactosidase / Lactase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAGGCGGTGTTCAGGGCAGGTTGTGCGT |
| Internal bar code: | TGGTTCTTTAGAGGCTACACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1391 |
| LEAP-Seq percent confirming: | 99.2272 |
| LEAP-Seq n confirming: | 29276 |
| LEAP-Seq n nonconfirming: | 228 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCTCAAGCCAGAGTAGGG |
| Suggested primer 2: | CCCACACTCACCACACACTC |