| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092870 |
| Chromosome: | chromosome 6 |
| Location: | 8795565 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g310050 | CPL13 | Conserved in the Plant Lineage; (1 of 1) PTHR10794//PTHR10794:SF53 - ABHYDROLASE DOMAIN-CONTAINING PROTEIN // CAAX AMINO TERMINAL PROTEASE FAMILY PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCAGCACTCGGCGGCATCAGCGTCGCC |
| Internal bar code: | TCGCCTGAGCCTCGCGACCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 83 |
| LEAP-Seq percent confirming: | 60.2584 |
| LEAP-Seq n confirming: | 793 |
| LEAP-Seq n nonconfirming: | 523 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCCCAAACTACACCGAAT |
| Suggested primer 2: | TACATCGCTGGTAGCTGACG |