Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.092929 |
Chromosome: | chromosome 16 |
Location: | 7332247 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g684603 | (1 of 4) PTHR11207//PTHR11207:SF0 - RIBONUCLEASE III // RIBONUCLEASE 3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCACATGGCATGGCCACCTGCTGCAGCC |
Internal bar code: | CACTGACGGCACTGGGCGCACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 335 |
LEAP-Seq percent confirming: | 82.0918 |
LEAP-Seq n confirming: | 1091 |
LEAP-Seq n nonconfirming: | 238 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCAGACGTAGAGGCACAG |
Suggested primer 2: | CGCACATCAGTAGCAAGCAT |