| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092954 |
| Chromosome: | chromosome 9 |
| Location: | 4363790 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395139 | (1 of 2) PTHR10283//PTHR10283:SF21 - SOLUTE CARRIER FAMILY 13 MEMBER // ARSENICAL PUMP MEMBRANE PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGAGCTCGCCCGCCCGTACGCGCGTGT |
| Internal bar code: | ACTACGAGCTGCTGGATGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 291 |
| LEAP-Seq percent confirming: | 57.8024 |
| LEAP-Seq n confirming: | 2241 |
| LEAP-Seq n nonconfirming: | 1636 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTACGGGGTGAAACGTCAG |
| Suggested primer 2: | AACGTACATCGGTAGCTGGG |