| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092986 |
| Chromosome: | chromosome 7 |
| Location: | 5901065 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g353950 | XPG5 | DNA repair 5'-3' exonuclease; (1 of 1) 3.1.11.1 - Exodeoxyribonuclease I / Exonuclease I | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCATGCTGCCGACAGCTCGCCTGCCCGC |
| Internal bar code: | GAGTTTCGGGAGAGGCACGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 223 |
| LEAP-Seq percent confirming: | 74.0863 |
| LEAP-Seq n confirming: | 5392 |
| LEAP-Seq n nonconfirming: | 1886 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGCTATTCCCAGTAAGC |
| Suggested primer 2: | TCCCTTCACTTGTAATCCGC |