| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.093016 |
| Chromosome: | chromosome 9 |
| Location: | 4829349 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397512 | HSPBP1 | hsp70-binding protein 1; (1 of 1) K09562 - hsp70-interacting protein (HSPBP1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTATAGATTTGAATGGACGCAGCCGCCT |
| Internal bar code: | CGCGTACTTACGGTAGGGATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 593 |
| LEAP-Seq percent confirming: | 98.6621 |
| LEAP-Seq n confirming: | 4867 |
| LEAP-Seq n nonconfirming: | 66 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCCCAATTCCTCAAGGTG |
| Suggested primer 2: | GCGGGAATGTACTCACCACT |