Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.093258 |
Chromosome: | chromosome 10 |
Location: | 5739261 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g461000 | (1 of 1) K14772 - U3 small nucleolar RNA-associated protein 20 (UTP20) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGGCGGCGCGCGCACCCGCGGAGCGGC |
Internal bar code: | TATAACGACGACAGGACTGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 557 |
LEAP-Seq percent confirming: | 92.4701 |
LEAP-Seq n confirming: | 1314 |
LEAP-Seq n nonconfirming: | 107 |
LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGAAAGCCCCTCACATCAG |
Suggested primer 2: | GTGGCACAGGTCAGTAGGGT |