| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.093267 |
| Chromosome: | chromosome 9 |
| Location: | 3355474 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388652 | (1 of 25) IPR000210//IPR011333 - BTB/POZ domain // POZ domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCTGCGTCGCCACCTCCGGCTCGGGATC |
| Internal bar code: | GGCTGGCAGACGTGGGCAGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 50 |
| LEAP-Seq percent confirming: | 88.9986 |
| LEAP-Seq n confirming: | 1262 |
| LEAP-Seq n nonconfirming: | 156 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCAATGTAAGGATGTGCT |
| Suggested primer 2: | TGCTATCAGCACTGGTGAGG |