Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.093302 |
Chromosome: | chromosome 16 |
Location: | 4368269 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g671500 | (1 of 781) IPR000104 - Antifreeze protein, type I | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAGGTGTGGGTGCGGGGGGCGGGGGGC |
Internal bar code: | CGTTGTTTTTTCACGCCTTCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 295 |
LEAP-Seq percent confirming: | 79.4643 |
LEAP-Seq n confirming: | 89 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCCACACCTTCTGTGTCG |
Suggested primer 2: | ACCCAGAGTCACTGACCCAC |