| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.093318 |
| Chromosome: | chromosome 1 |
| Location: | 1622446 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g008500 | (1 of 2) PF12796//PF13857 - Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGAACGGGAAACGCGCTATCGCGCCTGC |
| Internal bar code: | GTTCACAGGTAGACTGGTCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 489 |
| LEAP-Seq percent confirming: | 97.9381 |
| LEAP-Seq n confirming: | 95 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACACACACGGTCCCTCTC |
| Suggested primer 2: | AAGATTGTTGACAGTGGCCC |