| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.093336 |
| Chromosome: | chromosome 12 |
| Location: | 6971987 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g560150 | RAB1,FAP353,RABD1 | (1 of 1) K07874 - Ras-related protein Rab-1A (RAB1A); Rab-like GTP-Binding Flagellar Associated Protein 353 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCTCTGGCCGTGCATGGCTGCAGGTTGG |
| Internal bar code: | GGCCGACCTGGTGTGACGTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 207 |
| LEAP-Seq percent confirming: | 96.7092 |
| LEAP-Seq n confirming: | 1440 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCGCCAAGAAAGTGTCAG |
| Suggested primer 2: | CATCAACAGCAAGTCGTCGT |