Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.093340 |
Chromosome: | chromosome 2 |
Location: | 2448763 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g091700 | RIB72 | Flagellar protofilament ribbon protein 72; (1 of 1) PF06565//PF13499 - Repeat of unknown function (DUF1126) (DUF1126) // EF-hand domain pair (EF-hand_7) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTAAGCAGTATACGCCTTCGCCGAACCA |
Internal bar code: | GGCTGGGTGAGTTTAGGAGGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 617 |
LEAP-Seq percent confirming: | 99.3528 |
LEAP-Seq n confirming: | 1228 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTCGAGGGTGTCGTTCATT |
Suggested primer 2: | CTGTAAGCAGGGAGAGGCAC |