| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.093473 |
| Chromosome: | chromosome 1 |
| Location: | 4147186 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g027350 | TMG10 | (1 of 2) PTHR12029:SF11 - METHYLTRANSFERASE TARBP1-RELATED; tRNA (guanosine-2'-O)-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAGCGAGGGGGAGAGGGGGAGGCGGGGG |
| Internal bar code: | ATACAATGACCCAGATGGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 191 |
| LEAP-Seq percent confirming: | 63.329 |
| LEAP-Seq n confirming: | 487 |
| LEAP-Seq n nonconfirming: | 282 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATGGACGGACCTACTGAA |
| Suggested primer 2: | ATCTCTCCCACCCATTTTCC |