| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.093506 |
| Chromosome: | chromosome 6 |
| Location: | 8220872 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g305650 | PAO6,Tic55-like4,TIC55-4 | Pheophorbide a oxygenase-related protein; (1 of 8) 1.14.12.20 - Pheophorbide a oxygenase / Pheide a oxygenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAATTTCACTGTGCACACGACATGGAGT |
| Internal bar code: | CAAAATCCAAAGGGGCCGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 105 |
| LEAP-Seq percent confirming: | 43.5811 |
| LEAP-Seq n confirming: | 129 |
| LEAP-Seq n nonconfirming: | 167 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGAGTCGCGTGAGGAAATC |
| Suggested primer 2: | TAGAGGTAAGGGGCCTTGGT |