| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.093567 |
| Chromosome: | chromosome 3 |
| Location: | 4588471 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g176961 | (1 of 37) IPR009030 - Insulin-like growth factor binding protein, N-terminal | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGCCTTTTAATGGTTGCAAACGCCCCCC |
| Internal bar code: | ATGGGCCCACCGACGGAGAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 421 |
| LEAP-Seq percent confirming: | 95.6612 |
| LEAP-Seq n confirming: | 926 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCAATGCTGTCGTGCTTA |
| Suggested primer 2: | ATCTGTACGGACACGGTGGT |