Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.093577 |
Chromosome: | chromosome 6 |
Location: | 3684641 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278140 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTGGGGCTGGGGAAGGTCAGGCGAGGCG |
Internal bar code: | CCCTATCTGGCCACGTGGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 605 |
LEAP-Seq percent confirming: | 99.5575 |
LEAP-Seq n confirming: | 1125 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCAGGAACTCGTACTGGC |
Suggested primer 2: | CATCTGACACCCTACTCGCA |